Dropseqpipe

Changed
- pre_align steps will output a fastq.gz instead of a fastq file.
- `fastqc.R` is now compatible with paired and single end data.
- Changed a few options in `GLOBAL` for `UMI` and `Cell_barcodes` options. Now possible to change filtering settings. See [WIKI](https://github.com/Hoohm/dropSeqPipe/wiki/Create-config-files)
- STAR logs have been stripped of the `STAR` string. This is to allow for better compatibility with [multiqc](https://github.com/ewels/MultiQC/)
- Removed `fastqc` folder and moved items to `logs` folder. Grouping all logs files for better [multiqc](https://github.com/ewels/MultiQC/) compatibility.
- Changed `generate_meta` to `generate-meta` for keeping similar syntax between modes.
- Added seperate log files for stats and summary in the DetectBeadSynthesisErrors.
- Moved part of the `README`to the wiki.
- Changed the name of the first expression matrix extracted before the species plot to `unfiltered_expression.`


Added
- You can now run Bulk Single or paired end RNAseq data.
- Started a wiki with a FAQ
- Added options in `GLOBAL` config.yaml. You can now choose a range of options for UMI and Barcode filtering. please refer to the wiki for more information.
- Support for [MultiQC](https://github.com/ewels/MultiQC/). MultiQC is a great way of summarising all of the logs from your experiment. As of today it supports 46 different modules (such as fastqc, trimmomatic, STAR, etc...) The `generate-plots` mode now produces a `multiqc_report.html` file in the plots folder.
- New plot! BCDrop.pdf is a new plot showing you how many barcode and UMIs you dropped from the raw data before aligning. This helps to track how many samples you might loose because of low quality reads in the barcoding.

Changed
- all `subprocess.call` replaced by `shell` from snakemake
- STAR aligner now not limited to 8 cores or threads but will use the maximum number provided in the local.yaml file
- Name from dropSeqPip to dropSeqPipe
- Fixed a bug where all stage1 steps used the same summary file. Now BC tagging, UMI tagging, starting trim and polyA trim have different summary files
- extract-expression now merges all the samples final count matrix into one per run (folder)
- Fixed a bug where the amount of total reads on the knee-plot was overinflated.
- Changed `knee-plot` mode to `generate-plots`.

Added
- Temp files have been added in the pipeline. You can turn this off by using the `--notemp` option
- fastqc mode now available. Generates fastqc reports plus summary plots
- Summary file and plot for fastqc and STAR logs
- Missing R packages should install automatically now. No need to install them beforehand. Report any problem plz
- `GLOBAL` values in the config files are now available. They allow to change UMI and BC ranges as well as mismatches for STAR aligner
- Added a new mode: generate_meta. This allows to create all the metadata files needed for the pipeline. You just need a folder with a genome.fa and an annotation.gtf

Added
- Changelog file to track changes
- --rerun option to force a rerun
- Multiple steps allowd now

Changed
- The pipeline is now a python package being called as an executable
- Went from json to yaml for config files

Added
- setup.py and dependencies
- Species plot available

Removed
- primer handling, went to default: AAGCAGTGGTATCAACGCAGAGTAC

First release
- Allows for preprocessing, alignement with STAR, post align processing until knee-plot