Rna-tools

- Fix scrutinizer and small fixes

- rna_calc_inf.py:
- --renumber-residues
- clean sel pdb files, and --dont-remove-sel-files
- force to run ClaRNA even if <pdb>.outCR file is there, for will be auto True when selection defined
- rna_calc_inf.py: up readme
- rna_calc_inf.py: with model_selection and target_selection
- Fix problems with rna_calc_inf.py, re-write tests, add docs

- rna_pdb_tools.py:
- add --no-progress-bar
- add --color-seq
- add --rpr for --mutate

- diffpdb.py: fix --names-and-resi

Update update_readme.py and update readme (Used in papers)

Bug fixes and small improvements.

200626

- rna_pdb_tools.py: --undo --suffix --hide-warnings
- rna_pdb_tools.py: add fetch RNA-Puzzles standardized_dataset
- rna_pdb_tools.py: --to-mol2
- include mini-moderna3
- add spotifier https://github.com/mmagnus/rna-tools/tree/master/rna_tools/tools/spotifier
- add webserver-engine https://github.com/mmagnus/rna-tools/tree/master/rna_tools/tools/webserver-engine

- 200330 read the docs py3 now https://readthedocs.org/projects/rna-tools/builds/
- 190821
- Add `rna_alignment/rna_align_foldability.py`
- Seq.py now you can set .name
- Seq.py mc-fold:
- Add: explore option
- Change: verbose now also shows full output of the program
- Add: comment field for some extra information from the program
- 190820 Add: rna_align_distance_to_seq.py
- 190815 Add: Seq.py: load_fasta_ss_into_RNAseqs()
- 190813 Add: copied and edited from rna_pdb_merge_into_one.py to:

rna_pdb_tools.py --nmr-dir . 'cwc15_u5_fragments*.pdb' > ~/Desktop/cwc15-u5.pdb

- 190810 Add: ENTRNA wrapper for foldability

Added

- `rna_dot2ct.py`
- `rna_pdb_tools.py --swap-chains SWAP_CHAINS` [190530]
- Clanstix: with smart group name picking [190500]
- `rna_pdb_tools.py --split-alt-locations`
- `rna_pdb_tools.py --delete-anisou`
- copied and edited from rna_pdb_merge_into_one.py to `rna_pdb_tools.py --nmr-dir . 'cwc15_u5_fragments*.pdb' > ~/Desktop/cwc15-u5.pdb` [190813
]

Changed
- Rename `rna_ss_pred.py` to `rna_secondary_structure_prediction.py`
- Changed all underscores into dashes in arguments, .e.g --get_seq to --get-seq 94 [190529]
- PyMOL4RNA: scale down shapes for inorganic, to 0.25

Fixed
- Clanstix problem with group and coloring bug 91

History

170814 Python3 everywhere (at least it should be)

170608 Add `--get_ss` (secondary structure) using x3dna.

170518 Edit in place [experimental, only for `get_rnapuzzle_ready`] `rna_pdb_tools.py --rpr 7_Das_7_rpr.pdb --inplace`. (2) get a structure in org-mode format <sick!>

170517 Fix 37 mis-align atom names after rpr-ing bug

170515 Fix fixing missing O2'

170404 `rna_simrna_extract.py -t template.pdb -f *05.trafl -c -n 1 extract only the first model`

170331 rna-pdb-tools meets Emacs!


170325 Seq: secondary structure prediction with constraints

>>> seq = Seq("CCCCUUUUGGGG")
>>> seq.name = 'RNA03'
>>> print(seq.predict_ss("RNAfold", constraints="((((....))))"))
>RNA03
CCCCUUUUGGGG
((((....)))) ( -6.40)

170324 Starting converting to Python3, fetch_align by Pietro

170320 `rna_cartoon` in PyMOL


170319 Add clanstix (move it from its own GitHub repository).

170315 SimRNA_trajectory:
- get len of frame, and trajectory
- warn about broken frame
- `only_first_frame` to get only the first frame

170311 Get seq (v2) gets segments of chains with correct numbering

> 6_solution_0 A:1-19 26-113 117-172
GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGA

170308 Add fixing missing atoms of bases, and O2'

... many things! :-)

~2011 Prelimiary version as rnastruc, yapdb_parser etc.